Yerlan

FAQ

Нужен ли нам ДНК-паспорт?   13 members have voted

  1. 1. Хотели бы Вы подать свою пробу на ДНК анализ?

    • В этом нет никакой необходимости
      0
    • В какой то степени это интересно
      0
    • Это интересно, но мне страшно узнать правду
      1
    • Это интересно, но стоимость анализа слишком высокая
      6
    • Это безумно интересно, дайте мне знать как сделать заявку
      6

Please sign in or register to vote in this poll.

194 posts in this topic

Kymbatty otandastar,

pikirlerinizge kob rahmet!

Share this post


Link to post
Share on other sites

Уважаемые, в данной открытой теме предлагается накапливать всю имеющуюся информацию по изучению генеалогии человека на основе анализа ДНК-маркеров.

Можно приводить любую информацию: развитие проекта генографии, частные успешные проекты, новые технологии, карты, статистика, геном, хромосомы, маркеры, праймеры, и т.д., вплоть до мельчайших подробностей.

 

Естественно, наш главный фокус это изучение генеалогии казахов на основе использования ДНК-маркеров.

 

Если у кого нибудь возникли вопросы, не стесняйтесь, задавайте, от самых простеньких до самых серьезных. Мы всегда будем рады общению, и по мере возможности, будем стараться отвечать на все ваши вопросы.

 

В общем, присоединяйтесь к беседе, к разговору. Давайте вместе повышать наш общий уровень знаний.

 

Вопросы политического и расисткого характера будут оставаться без внимания и удалятся. Спасибо.

Share this post


Link to post
Share on other sites

В настоящее время существуют два основных пути построения генетического дерева землян.

 

Первый путь это изучение генеалогии по отцовской линии через анализ Y-хромосомы.

Известно, что Y-хромосома интактно (без изменении) передается от отца к сыну, таким образом, через анализ Y-хромосомы любой мужчина может заглянуть в свою историю на тысячи лет назад и проследить пути передвижения его прапрапра.... предков. К сожалению (или к счастью), женщины не имеют Y-хромосомы, поэтому узнать свою генеалогию по отцовской линии они могут лишь через своих родных братьев и родственников мужского рода по отцовской линии.

 

Второй путь построения дерева это изучение генеалогии по материнской линии через анализ митохондриальной (мт) ДНК. Известно, что при спаривании мужских и женских клеток, мт ДНК мужчин уничтожается.

Таким образом, и мужскому и женскому потомству достается мт ДНК по материнской линии. Этот отрадный факт позволяет проследить свою генеалогию по материнской линии как женщинам, так и мужчинам.

 

Есть еще и третий путь, анализ аутосомных (не половых) хромосом и Х-хромосомы. Но поскольку в этом случае хромосомы полученные от родительских форм активно обмениваются своими участками, то этот подход используется генетиками-популяционистами для выполнения определенных научных проектов.

 

Поскольку казахи в своих шежире используют родословную по отцовской линии, нам скорее всего интересен первый путь. Но, безусловно, каждый человек вправе проследить свою генеалогию и по материнской линии.

Вам достаточно подать Вашу пробу один раз, и ФТД, при наличии Вашего заказа, может сделать анализ и по отцовской и по материнской линии.

Share this post


Link to post
Share on other sites

Для анализа Y-хромосoмы используются STR (микросателлитные тандемные повторы) и SNP (полиморфные нуклеотиды) маркеры, для мт ДНК используются SNP маркеры. Сходства и различия индивидуумов и этнических групп изучается на основе различии по этим двум классам маркеров. Чем больше индивидуумов изучено, и чем больше маркеров использовано в анализе, тем точнее окончательный результат.

На данный момент, карты и деревья по Y-хромосоме и по мт ДНК выглядят так : http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf

Конечно же, на данном этапе это не совсем точные данные, поскольку изначально было использовано недостаточно большое количество образцов и маркеров. Но для начала это великолепный старт!

Share this post


Link to post
Share on other sites
Из российского сайта:

Кто они, наши предки?

Каждый из нас когда-нибудь задавался вопросом

и задумывался о том, кем же были его предки.

И погружаясь в будничные проблемы ежедневно,

и смотря сквозь призму столетий наши предки

нам кажутся такими далекими и такими близкими.

А между тем все они были похожи на нас... со

своими проблемами, со своими мыслями. Они

относились к разным сословиям, у них были

разные профессии, и они передали нам свой

"генетический отпечаток" и свое имя.

Разве не интересно этот отпечаток нам, современным потомкам, сейчас всем выявить и протянуть его до себя и продлить в своих потомках.

А сколько казахов оказалось без своего шежире. не знающих своего происхождения.

Если мы выявим родовые корни, то практически сможем определить происхождение любого казаха.

:rolleyes: :rolleyes: :rolleyes: :rolleyes: :rolleyes: :rolleyes:

Из стихов Мурата Увалиева

Мои предки далекие. Кто вы?

Может черная кость, а быть может торе.

А может быть воин суровый.

Блеск металла еще не потух,

и во мне возрождается вновь

тот же гуннский воинственный дух,

половецкая вольная кровь.

Я теперь ощутил, как глубок,

непрерывен и древен мой род.

В хромосомах, сплетенных в клубок,

прочитал генетический код.

В стихах это удается поэтам.

Более подробно можно посмотреть в родственном российском сайте:

также на английском в материнском сайте, который ведет и нашу

казахскую страницу

http://www.familytreedna.com/(zihd2a55r4g0...&code=X9182

Karta gaplogrupp narodov mira uzhe sushestvuyut:

http://www.scs.uiuc.edu/~mcdonald/WorldHaplogroupsMaps.pdf

i

http://www.familytreedna.com/haplotree.html

Share this post


Link to post
Share on other sites

post-3-1172869924_thumb.jpg

 

Так выглядит упрощенная кладограмма (дерево) ДНК человека, построенная на основе анализа Y-хромосомы.

На каждом звене кладограммы (помечено той или иной буквой) была обнаружена определенная мутация в локусах Y-хромосомы. Корень кладограммы начинается от звена (гаплогруппа) А. Возраст гаплогруппы А равняется примерно 60 тысяч лет, это наиболее древняя группа землян. Местом происхождения этой группы является Восточная Африка.

Самой молодой подгаплогруппой, показанной на карте, является подгаплоруппа R1а, возраст этой подгруппы 10 тысяч лет. Местообитание группы R1а это регионы России и Кавказа.

Share this post


Link to post
Share on other sites

post-3-1172955636_thumb.jpg

 

Прежде чем обсудить Y-хромосому, давайте взглянем на геном человека. Как известно, в геноме человека имеется 23 пары хромосом. Двадцать две пары хромосом называются аутосомными, а 23я пара (X и Y хромосомы) определяет пол человека и называется половой парой хромосом. Размер тотальной ДНК, рассредоточенной в этих 23 хромосомных парах равен 3.2 миллиардам нуклеотидных пар оснований. Человек с комбинацией хромосом ХY является мужской особью, а с комбинацией ХХ - женской. Известно, что одна из пар 23 хромосом достается нам от отца, вторая от матери. При этом, все аутосомные хромосомы и Х хромосомы активно обмениваются участками между материнскими и отцовскими копиями хромосом. Объект нашего внимания, Y-хромосома, передается от отца к сыну практически в незатронутой форме. Есть несколько научных работ, свидетельствующих о том, что концевые регионы Y-хромосомы обмениваются своими участками с концевыми участками Х-хромосомы. Однако, по своей протяженности, эти регионы являются достаточно короткими. Кроме того, при выборе ДНК маркеров, используемых в генеалогии по мужской линии, предпринимаются все необходимые шаги для того, чтобы никак не затрагивать регионы подверженные обмену участков ДНК.

Share this post


Link to post
Share on other sites

post-3-1173128023_thumb.jpg

 

Схематический рисунок Y-хромосомы и приблизительное расположение наиболее широко используемых STR маркеров.

Share this post


Link to post
Share on other sites

Здесь приведены сиквенсы праймеров (специфические нуклеотидные последовательности), которые используются в амплификации ДНК маркеров Y-хромосомы:

Share this post


Link to post
Share on other sites

В Youtube появились нарезки фильма Спенсера Веллса об эволюции человека под названием "Journey of Man: A Genetic Odessey".

Фильм состоит из 13 частей, смотрите нарезок за нарезком.

Здесь адрес первого нарезка:

Обратите внимание на нарезок 9. Веллс утверждает, что предки казаха Ниязова стояли на важном перекрестке генеалогии человека.

Share this post


Link to post
Share on other sites

1. Что такое SMGF?

Фонд Молекулярной Генеалогии Соренсона это бесприбыльная организация, которая занята созданием главной всемирной

коллекции ДНК результатов и соответствующих генеалогий. Мы создаем коллекцию, доступную общественности в режиме он-лайн,

для помощи людям в поиске новых родственных связей и расширения своих генеалогий. ФМГС не объединяется с какими-либо

коммерческими организациями, религиозными обществами или другими проектами тестирующими ДНК.

 

2. Что будет делать Фонд с моим образцом ДНК и информацией о генеалогии?

Независимая лаборатория обработает Ваш образец, потом мы добавим Ваши результаты и семейное дерево (предков рожденных до

1906 года) в базу данных Соренсона на этом веб-сайте. Ваша генетическая информация хранится в Фонде в безопасной базе

данных, а Ваш образец ДНК, который хранится в Геномной лаборатории Соренсона, можно определить с помощью

идентификационного кода. Лаборатория не хранит никакой персональной информации о предоставителе образца.

 

3. Какую пользу получаю я, участвуя в проекте Фонда Молекулярной Генеалогии Соренсона?Ваши результаты ДНК анализа и родословная будут добавлены в Базу Данных Соренсона, помогая Вам создать новые родственные

ветви в семейном дереве. Ваша информация также может помочь другим людям создать свои связи, основываясь на вашем

вложении.

 

4. Получу ли я результаты своего ДНК от Фонда?

Из-за особенности нашего проекта, Вы не можете получить свои результаты напрямую из Фонда. Однако, Ваши результаты и

генеалогия будут добавлены в Базу Данных Соренсона, и их легко можно найти через поиск своей фамилии или просмотр близких

семейных деревьев.

 

5. Когда мои результаты появятся в Базе Данных Соренсона?

Мы обрабатываем образцы большими партиями, чтобы снизить цены. Время между поступлениями партий зависит от количества

получаемых образцов за месяц. Также мы проверяем информацию в схемах родословных, перед добавлением информации в нашу

базу данных. Поэтому мы не можем предсказать точное время, необходимое для обработки и добавления Ваших результатов в

Базу Данных Соренсона.

 

6. Как производить поиск в базе данных Фонда?

Просто зайдите на страницу Поиска (Search) и введите нужную фамилию. Вы также можете ввести известные результаты ДНК или

использовать текущие значения ДНК. Для подробной информации смотрите секцию Помощь на странице Поиска.

 

7. Что значат результаты поиска?

Результаты поиска покажут значения для всех участников, которые совпадают с вашими критериями поиска. В основном, высшее

совпадение (например, 35/36 вместо 34/36) означает ближайшую генеалогическую связь. Мы также предоставляем ссылки на

схемы родословных и Время до Самого Общего Предка (ВСОП) для более тщательного соответствия. Страницы с ВСОП и

результатами показывают дальнейшую информацию для помощи в интерпретации.

 

8. Как мне определить значения близких соответствий?

Для защиты личных интересов, мы не можем открыто отображать несоответствующие результаты. Однако, Вы можете определить

значения несоответствующих показателей, изменяя значения ввода нужных показателей, затем просматривая результаты пока не

увидите ближайшее совпадение.

 

9. Почему Фонд выбрал существующий набор показателей У- хромосом?

Показатели У-хромосомов Фонда представляют набор (совокупность) стабильных показателей с умеренной степенью мутации и

достаточной генетической изменчивостью пригодной для генеалогических целей. Заметьте, что мы не включаем показатели,

используемые другими тестирующими компаниями, но имеется много совпадений по которым можно сравнивать показатели из

других компаний.

 

10 Как я могу контактировать с другими участниками проекта Фонда?

Для защиты личных интересов, мы не показываем никакой персональной информации наших участников, или имена предков,

рожденных после 1906 года. Вы можете найти ссылки на предков в схемах родословных Фонда на досках сообщений и в

коллекциях семейных деревьев. Пожалуйста, смотрите страницу Ссылки для возможных источников соответствующей информации.

 

11 Можно ли мне сдать тестовый отчет из коммерческой тестирующей лаборатории в Фонд?

12. В чем различие между поиском в базе данных соренсона и присоединением к проекту фонда?

13. Я участник проекта Генография от National Geographic. Обязательно ли мне присоединятся к проекту Фода?

14. Сотрудничает ли фонд с религиозными орг?

15. Что такое Купон тестирования ДНК?

16. Почему изменилась моя схема родословной?

17. Почему количество фамилий в системе уменьшилось?

18. Что такое Номер Потомственного Файла?

Share this post


Link to post
Share on other sites

Представляю Вашему вниманию любительский фотоотчет о прошедшей лекции д-ра Спенсера Уэллса, проведенной на Географическом факультете МГУ, на тему о проекте "Генография".

28 мая 2007 год. 15.00 (мск)

См.: Dr. Spencer Wells's lecture in Moscow

Share this post


Link to post
Share on other sites

В соседней теме есть ссылка на фильм в Youtube.com созданного именно этим специалистом.

Share this post


Link to post
Share on other sites

Продолжим ознакомление с темой, при помощи видеоматериалов:

Обращайте внимание на наличие других видеороликов, при просмотре предложенных.

Share this post


Link to post
Share on other sites

Возможно, кому-нибудь пригодится сайт

logo2.gif

 

Сайт DnaTube - это сайт, содержанием которого являются видеоматериалы, основанные на научных занятиях, лекциях и семинарах. Название сайта говорит само за себя о тематике сайта.

 

Будет здорово, если в данной теме появятся избранные ссылки на самые интересные видеоролики (с указанного сайта) по тематике генеатической генеалогии.

Share this post


Link to post
Share on other sites

Здесь подробная карта филогенетического древа человечества, построенная на основе использования маркеров Y-хромосомы:

http://www.familytreedna.com/haplotree.html

Share this post


Link to post
Share on other sites

Илияс,

приветствую Вас на форуме.

 

Список SNP праймеров приведен в сообщении чуть выше.

 

Праймеры для специфических STR маркеров надо поискать в инете.

Основные праймеры можно найти в реферате Schoske (2003),

там же можете познакомиться с технологией multiplexing.

Файл слишком тяжелый, высылаю Вам на ящик.

 

Надеюсь что это поможет Вам.

Share this post


Link to post
Share on other sites

на всякий случай кидаю таблицу 3 сюда:

 

 

Table 3-3

Primer sequences for PCR amplification of loci used for DNA sequencing. All primer concentrations were

1.0 mM. Primer sequences differing from those used in the multiplex assays are in bold.

Locus Primer Sequences (5’ to 3’)

DYS19 F ACTACTGAGTTTCTGTTATAGTGTTTTT

R GTCAATCTCTGCACCTGGAAAT

DYS385 F GCTGAGGCAGGGTAATTGTT

a/b R TAAGGGCTGCTGACCAGATT

DYS388 F GAATTCATGTGAGTTAGCCGTTTAGC

R GAGGCGGAGCTTTTAGTGAG

DYS389 F CCAACTCTCATCTGTATTATCTATG

I/II R TTATCCCTGAGTAGTAGAAGAATG

DYS390 F TGGGATGGGAAATGATGTTT

R ACAATGCAAATGATGAAAGAAA

DYS391 F GCTGAGGTCAAGTAACCCTGTC

R TTTGTGGTGGGTCTGTCTTG

DYS392 F CCCACTCTTGGCATCTAGTGA

R GGAAGCTAGCAAGACTTCAGAAA

DYS393 F GTGGTCTTCTACTTGTGTCAATAC

R CTAAATAAAGTCATATCAGCTGC

DYS426 F TGGCCATCTCCTTTATTTGG

R GTGAGCCGAGAGAGAGATCG

DYS435 F GGGTTGTCCAGAGAAACAGC

R CCCCCTCCTCTCGTCTATC

DYS436 F GTTTCACAGCGTTCATTGGA

R GCTACTCCCAGCCAAAACTG

DYS437 F GACTATGGGCGTGAGTGCAT

R AGACCCTGTCATTCACAGATGA

DYS438 F CCAAAATTAGTGGGGAATAGTTG

R ATCACCCAGGGTCTGGAGTT

DYS439 F TCGAGTTGTTATGGTTTTAGGTCT

R TGGCTTGGAATTCTTTTACCC

DYS447 F GGTCACAGCATGGCTTGGTT

R GGGCTTGCTTTGCGTTATCTCT

DYS448 F TGGGAGAGGCAAGGATCCAA

R TCATATTTCTGGCCGGTCTGG

DYS460 F CCACAGTAAAAGGGCTCCAC

(A7.1) R TGATGCTGTGTCACTATATTTCTGTT

H4 F TGGACAGAGTGGGTTCTGAAG

R TGGTCAAAACACCATTTCCTC

DYS461 F CCACAGTAAAAGGGCTCCAC

R TGATGCTGTGTCACTATATTTCTGTT

Share this post


Link to post
Share on other sites

Уважаемые посетители!

На днях исполняется маленькая круглая дата ДНК-проекту казахов, нам уже год!

Мы медленно, со скрипом, но верно набираем свой ход. Я считаю, что причастные к проекту лица проделали большую полезную организационную работу. За прошедший год был заново реорганизован Форум, что помогло упорядочить ведение проекта. Организована инициативная группа, которая вела важную работу по закладке фундамента проекта. Была налажена связь с наиболее активной компанией в мире, которая обслуживает всех желающих изучать генеалогию свой семьи, с ФТДНК, расположенной в городе Хьюстон, США.

Была собрана минимальная необходимая информацию, позволяющая поближе познакомиться с основами ДНК-генеалогии. Была оказана безвозмездная помощь для наших самых информированных и инициативных граждан в изучении своей собственной генеалогии. Менеджмент проекта провел большую работу по популяризации проекта в стране. Проект освещался в СМИ, как на экранах ТВ, так и в центральных газетных изданиях.

Как вознаграждение за проделанную работу, мы получили первые наши ростки - ДНК результаты по Y-хромосоме, мт ДНК, и аутосомным хромосомам для нескольких граждан, представляющих разные казахские рода.

Вместе с этим, есть понимание того, что проделанная работа это всего лишь начало начал.

Предстоящие работы кажутся гораздо сложнее. Нам предстоит наладить организационную работу по анализу ДНК казахов внутри страны, нам предстоит вовлечь в проект широкий круг специалистов в области истории, археологии, биологии, математики, журналистики, специалистов смежных дисциплин, и просто любителей истории.

Нам предстоит сложная задача по организации дискуссии по проблемам документальной и ДНК генеалогии казахов.

Самое главное, нам хотелось бы привлечь широкие слои населения страны для активного участия в ДНК-проекте казахов и родственных народов, и обсуждения общих проблем генеалогии на нашем форуме.

Двери ДНК-проекта открыты для всех. Мы будем рады любой помощи.

Последний момент, момент общения на форуме, на мой личный взгляд является наиболее проблематичным. Несмотря на прилагаемые усилия, форум пока очень далек до задуманного назначения - массовости и живого информативного обмена мнениями. По видимому, частичными проблемами этого является дорогая интернет-связь в стране, недостаточная информация о проекте, и высокие цены ДНК-анализа.

Вместе с этим, мне хотелось бы донести до нашего общества, что коллектив ведущий данную организационную работу, выполняет ее на общественном начале. У членов нашего коллектива есть своя, не связанная с ДНК-проектом, работа, и ДНК-проект является для нас безвозмездной попыткой принести пользу нашему обществу.

В эти последние дни уходящего 2007 года мне хотелось бы выразить признательность всему коллективу за великолепную работу. Хочу перечислить команду поименно - Олег Ханышевичь, Гаухар, Михайл, Нурлан, асан-кайгы, Серикбай и Илияс. Я хочу пожелать вам всем крепкого здоровья, хорошо встретить Новый Год, счастливого и удачного во всех отношениях 2008 года. Наконец, я хочу поблагодорить всех наших участников ДНК-проекта, которые одинаково причастны к нашим маленьким радостям. Спасибо Вам большое за Ваш персональный вклад в развитие проекта!

С Новым Годом!

Share this post


Link to post
Share on other sites

С некоторых пор я начал получать емайл сообщения, где утверждается, что наш проект несет определенный негативный момент, потому что подталкивает казахов в обособление на казахские рода.

Я полагаю, что такие сообщения и письма будут поступать и впредь.

Для того, чтобы не отвечать на каждое письмо я открываю эту тему, чтобы высказать свое личное мнение по данному вопросу и услышать мнения членов проекта и посетителей сайта.

 

На мой взгляд наш проект предназначен для изучение истории индивидуальной единицы общества - семьи. У проекта нет цели разбить единый народ путем возвеличивания одних родов в ущерб другим родам. Все казахские рода имеют славное историческое прошлое, и если какая то специфическая линия казахов активна в этом проекте, то это всего лишь свидетельствует о пассивности других линий, не более. Теперь, почему ДНК-проект разбивается по жузам и родам. Дело в том, что в отличие от европейских традиций, где семьи придерживаются в поддержке старинных фамилий (к примеру, Кемпбел в Шотландии), казахская семья придерживалась и придерживается других принципов - фамилия может поменяться уже в следующем поколении. В этой ситуации, единственными надежными маркерами в изучении генеалогии казахской семьи являются племена и рода. По существу, название родов это название нашей древней фамилии, и на мой взгляд трудно упрекать кого-то в том, что он не забывает свою древнюю фамилию.

Хотелось бы заверить всех, что проект не имеет никакого специфического предпочтения к какой-либо линии. К примеру, для нас представители многочисленных родов Младшего Жуза одинаково ценны с представителями Аксуек и других древних подразделений.

 

Я также хочу подтолкнуть к активности нашу аудиторию, которая говорит на нашем родном казахском языке. На сообщения на казахском языке, мы будем отвечать казахским языком. Кадiрлi каум, озiмiз бастамасак ешкiм бiзге сырттан комек бермейды. Mектептi орыс тiлiнде бiтiрсемде, казак тiлде жаубын жазуга тырысамын. Осы проектiмiздi дамыту ушын сiздeрден комек сураймыз. Mамандыгыныз тарих жагынан болсын, археология жагынан болсын, тагы да баска катынасатын салaлар жагынан болсын, комек ар жактанда оте кажетты. Бас косып осы кызыкты саяхaтты бiрге жасауга шакырамыз. Рахмет.

 

Был бы признателен всем членам проекта и инициативной группе за Ваше мнение по данному вопросу.

Share this post


Link to post
Share on other sites

Я тоже получал такие же письма.

Хотел бы выразить свою точку зрения.

Трайбализм - это такой же советский штамп, как буржуазный националист, панисламист и т.д.

Как такового трайбализма нет в Казахстане. Есть воспоминания о нем.

Например: Я аргын. если у меня будет выбор между двоюродным братом-коныратом и соплеменником аргыном, то выбор будет в пользу моего двоюродного брата и мне плевать на то, что он не аргын.

Все что у нас пытаются называть трайбализмом на самом деле давно уже называется блатом. И не надо путать одно с другим. Блат есть у всех народов, трайбализм у народов живущим в первобытном обществе (ну и при феодализме иногда, хотя не всегда)

Также хотел напомнить, что человек, не знаюший свое происхождение, не интересуещийся своим происхождением и историей своей семьи больше похож на манкурта, чем на борца с трайбализмом.

Человек не знающий прошлого, это человек не имеющий будущего. Для такого человека не интересно, кто жил до и кто будет жить после. у него девиз после нас хоть потоп. Еще историк ключевский сказал: история никогда ничему не учит, она только наказывает за вовремя не выученные уроки.

Share this post


Link to post
Share on other sites

Если обратиться к Исламу, к религии которую мы исповедаем, то там говориться что Всевышний разделил нас на племена чтобы мы не забыли друг друга.

Отдельные представители нашего общества которые обвиняют хранителей кочевой традиции знать свою родословную, возможно сами не догадываются что главным фактором который сохранил кочевые народы и их государственность является родо-племенной строй.

Естественно, сейчас другие времена, наступила эра информационных технологий и глобализации. И многие потомки кочевников уже смотрят на традиции своих предков по разному, и они на это имеют право. Но как бы мы ни думали, мы с терпением и уважением должны относиться ко всякой мысли не пересекая границы деятельности людей которые думают иначе. Я с глубоким уважением отношусь к тем людям как Ерлан, которые развивают подобного рода проекты по восстановлению древней традиции шежире. Неужели будет плохо от того что потомки древних кочевников чувствовали себя детьми одного отца, что каждый из нас имеет обязательно генетическую связь друг с другом, что наши судьбы и судьбы наших предков и потомков взаимосвязаны друг с другом. Я думаю от этого человек будет становиться добрее и уважительнее относиться к другим. Не будем забывать что Бог создал нас и разделил на племена чтобы мы не забыли друг друга. Пусть если кто то аргын то узнает другого своего родственника аргына, если представитель торе то торе. Давайте не предавать забвению своих родственников как далеки они не были друг от друга, мы же все дети одного отца. Не забывайте что у Вас через 400 лет будет около 10 000 потомков, вы бы хотели чтобы они забыли друг друга, кто их общий предок, я думаю вы желали бы совершенно другое своим потомкам. Так почему же некоторые люди против этого проекта и обвиняют в трайбализме людей которые пытаются сделать что то чтобы их потомки не забыли их.........?

Share this post


Link to post
Share on other sites

Пошу прощения за то что вмешиваюсь, просто мне очень близки высказанные вами точки зрения, мысли.

 

Очень четко сказано:

Также хотел напомнить, что человек, не знаюший свое происхождение, не интересуещийся своим происхождением и историей своей семьи больше похож на манкурта, чем на борца с трайбализмом.

Человек не знающий прошлого, это человек не имеющий будущего. Для такого человека не интересно, кто жил до и кто будет жить после. у него девиз после нас хоть потоп. Еще историк ключевский сказал: история никогда ничему не учит, она только наказывает за вовремя не выученные уроки.

 

"Чтобы знать, куда мы идем, необходимо понять, кто мы; чтобы понять, кто мы, необходимо знать, откуда мы родом..."

 

P.S. Еще раз прошу прощения. Более не буду вмешиваться в ваши родовые дискуссии, понимая, что это очень интимная тема для многих народов...

Share this post


Link to post
Share on other sites

У конкретных людей конечно есть слабые места. Например: имея длинную и богатую родословную (древнее шежире), можно не заметить, как это повлияет на твое отношение к людям, непомнящим родства.

Однако многие моменты истории перевраны до такой степени, что до истины можно докопаться только такими методами, как например: ДНК тесты, углеродное датирование, новые археологические факты или архивные источники, которые прячутся или замалчиваются из-за политической невыгодности для держателей таких архивов. Даже по количеству нестыковок и противоречий в религиозных книгах видно, какие нешуточные фальсификации допускались, чтобы обелить своих и очернить других, чужих. От таких моментов кочевые народы пострадали больше всех из-за малого количества своих письменных источников. А отношение к устным источникам было в основном недоверчивым. Можно подумать, что фальшивые письменные источники имеют большую ценность. Фальш может быть выявлена и с помощью ДНК тестов. Даже просто с биологической точки зрения знание родословной (тем более подтвержденной ДНК тестом) – это благо для предотвращения близкородственных связей (жетi атага дейi кыз алыспау, уйленбеу).

Извините за сумбурность изложения, но я все-таки поддерживаю увеличение знаний в генеалогии и ДНК тестировании.

Но в то же время ставить заслон от деления общества по родам тоже нужно. Эти моменты нужно гласно обсуждать и находить противоядие, чтобы не навредить нашей стране, недавно обретшей независимость.

Share this post


Link to post
Share on other sites

На прошлой неделе на Первом канале стартовал новый мрогосерийный документальный проект Льва Николаева под названием "Код жизни" о зарождении генетики до современных ее знаниях, в том числе и по интересующей нас Y - хромосоме. Очередные серии транслируются вечером каждый вторник. В первой серии авторы рассказывали об ученом Грегоре Менделе, священнослужителе из Брюнна (позже - город Брно), который первым в истории науки попытался разгадать загадки наследственности. Мендель начинал экспериментировать на мышах, но церковное начальство ему запретило. И тогда патер Мендель стал разводить в монастырском огороде душистый горошек, скрещивая сорта и выясняя, в каком из поколений появится больше зеленых, а в каком - желтых горошин. Закономерности, выявленные в результате своих многолетних трудов, Мендель описал и разослал крупнейшим ученым всего мира. Ответа ему пришлось ждать очень долго: во второй половине XIX века мало кто интересовался такого рода вопросами...

Сегодня на очереди вторая серия, где авторы покажут события в самом конце XIX - начале XX вв. В этот момент уже многие ученые интересуются тайнами наследственности, и каждый идет к разгадке своим собственным путем. Два лидера этой научной гонки - Николай Кольцов и Томас Морган. «Школе Кольцова» пришлось пережить события 1905 года, Первую мировую войну, октябрьский переворот 1917… Но, несмотря на разруху, голод, полное отсутствие средств, они выстояли и сделали множество открытий, благодаря которым имя Кольцова станет известно в Европе и США, а его метод войдет во все учебники биологии под названием «Принцип Кольцова». «Школе Моргана» повезло больше. «Исторические обстоятельства» мало отвлекали от научной работы. В Колумбийском университете в знаменитой «Fly room» - «Мушиной комнате» была проведена немыслимая по сложности работа по вычислению генов. По сути - Морган и его ученики заложили фундамент современной генетики… Найдя среди своих подопытных мушек одну белоглазую, Морган с учениками попытались воспроизвести белоглазость в одном из последующих мушиных поколений. Когда же в результате опытов новая белоглазая муха появилась на свет, Морган так гордился и так дорожил ею, что даже не оставлял в лаборатории на ночь, а уносил домой и ставил коробочку с драгоценной мухой рядом с кроватью. Благодаря этому эксперименту, Морган выяснил, что белоглазость передается по наследству только особям мужского пола, а следовательно - налицо зависимость от пола определенных мутаций…

Приятного Всем просмотра!

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!


Register a new account

Sign in

Already have an account? Sign in here.


Sign In Now